PCR:	Confetti wt
Name of Positive CTRL:	Confetti wt
Annealing Temperature:	58.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	mTUBB short F	527	10 µM	10.0 µl for 1ml	ACCGGGCCCTCACTGTGCCTG
	mTUBB short R	528	10 µM	10.0 µl for 1ml	CGTCCACGGAAGACGGCGGCA
	oIMR8545	585	100 µM	20.0 µl for 1ml	AAA GTC GCT CTG AGT TGT TAT
	oIMR8916	586	100 µM	20.0 µl for 1ml	CCA GAT GAC TAC CTA TCC TC
Expected Bands:	Band Size: 118.0	Description: mTUBB5-118	(text displayed in the image)
	Band Size: 386.0	Description: 386 wt	(text displayed in the image)
More Information in PDF:		view PDF