| PCR: | Confetti mut |
| Name of Positive CTRL: | Confetti mut |
Annealing Temperature: | 58.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 30 s | | Hot Start: | HS 57 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| 11341 | 584 | 100 µM | 20.0 µl for 1ml | GAA TTA ATT CCG GTA TAA CTT CG |
| mTUBB short F | 527 | 10 µM | 10.0 µl for 1ml | ACCGGGCCCTCACTGTGCCTG |
| mTUBB short R | 528 | 10 µM | 10.0 µl for 1ml | CGTCCACGGAAGACGGCGGCA |
| oIMR8916 | 586 | 100 µM | 20.0 µl for 1ml | CCA GAT GAC TAC CTA TCC TC |
|
| Expected Bands: | Band Size: 118.0 | Description: mTUBB5-118 | (text displayed in the image) |
| Band Size: 300.0 | Description: 300 mut | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |