PCR:	MyD88
Name of Positive CTRL:	MyD88
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	MyD88 extra	576	100 µM	10.0 µl for 1ml	ATCGGCTTAAGTTGTGTGTGTCCGACC
	MyD88 wild	577	100 µM	10.0 µl for 1ml	AAGGCCAAAGGGTGTGGTATTAGGACC
	Neo1500	578	100 µM	10.0 µl for 1ml	ATCGCCTTCTATCGCCTTCTTGACGAG
Expected Bands:	Band Size: 300.0	Description: 300 ko	(text displayed in the image)
	Band Size: 500.0	Description: 500 wt	(text displayed in the image)
More Information in PDF:		view PDF