| PCR: | PARP2-wt/mut |
| Name of Positive CTRL: | PARP2-wt/mut |
Annealing Temperature: | 62.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 40 s | | Hot Start: | Not yet |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| PARP-2 fw | 566 | 100 µM | 20.0 µl for 1ml | GGGACTCTGGTTTGGTGCCT |
| PARP-2 mut rev | 568 | 100 µM | 10.0 µl for 1ml | TAAGGGCAGCTCATTCCTCCCA |
| PARP-2 wt rev | 567 | 100 µM | 10.0 µl for 1ml | TGCTGCCGTCCCTTATTCTAAGCT |
|
| Expected Bands: | Band Size: 269.0 | Description: 269 mut | (text displayed in the image) |
| Band Size: 346.0 | Description: 346 wt | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |