| PCR: | sN1_Tga20 | ||||
| Name of Positive CTRL: | sN1 | Annealing Temperature: | 60.0 °C | ||
| Number of cycles: | 35.0 | Extension Time: | 50 s | ||
| Hot Start: | Not yet | ||||
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| sN1-Mut fwww | 542 | 100 µM | 10.0 µl for 1ml | TCAGCCCCATGGCGGTGGAT | |
| sN1-Mut revvvv | 543 | 100 µM | 10.0 µl for 1ml | CAGCCTAGACCACGAGAATGC | |
| Expected Bands: | Band Size: 140.0 | Description: sN1 | (text displayed in the image) | ||
| Band Size: 569.0 | Description: unspecific | (text displayed in the image) | |||
| More Information in PDF: | view PDF | ||||