PCR:	DplTMD
Name of Positive CTRL:	DplTMD
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	50 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	DplTMD-38	162	100 µM	10.0 µl for 1ml	atgcataccaccatgaagaaccggctgggtac
	DplTMD-56	163	100 µM	10.0 µl for 1ml	ATG CAT TTA CTT CAC AAT GAA CCA AAC
Expected Bands:	Band Size: 600.0	Description: 600 wt	(text displayed in the image)
	Band Size: 700.0	Description: 700 tg	(text displayed in the image)
More Information in PDF:		view PDF