PCR:	CreNurr
Name of Positive CTRL:	CreNurr
Annealing Temperature:	59.0 °C
Number of cycles:	35.0
Extension Time:	45 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	F19	531	100 µM	10.0 µl for 1ml	TCCTCATCCTCTCCCACATC
	R19	532	100 µM	10.0 µl for 1ml	GCGATGCAATTTCCTCATTT
Expected Bands:	Band Size: 386.0	Description: 386 BAC	(text displayed in the image)
	Band Size: 510.0	Description: 510 Actin	(text displayed in the image)
More Information in PDF:		view PDF