PCR:	LTbR del
Name of Positive CTRL:	LTbR del
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	40 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	352	80	100 µM	10.0 µl for 1ml	GCAAACCGTGTCTTGGCTGC
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	P441	529	100 µM	10.0 µl for 1ml	ACA GGG CAG ACA TTA GGG TTC C
Expected Bands:	Band Size: 317.0	Description: 317 del	(text displayed in the image)
	Band Size: 500.0	Description: Actin	(text displayed in the image)
More Information in PDF:		view PDF