PCR:	CR2 wt
Name of Positive CTRL:	CR2 wt
Annealing Temperature:	55.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	CR1/2 a	504	100 µM	10.0 µl for 1ml	TGTCAGGCTCCTCCTAAAATTAT
	CR1/2 b	505	100 µM	10.0 µl for 1ml	CTTTACAAAGACGGATTTCTATA
Expected Bands:	Band Size: 693.0	Description:	(text displayed in the image)
More Information in PDF:		view PDF