PCR:	Del-1 ko
Name of Positive CTRL:	Del-1 ko
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	45 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Del-1 fwd	104	100 µM	20.0 µl for 1ml	tcttgaatctctgacagggc
	LacZ	106	100 µM	20.0 µl for 1ml	tgtgagcgagtaacaacc
	mTUBB short F	527	10 µM	10.0 µl for 1ml	ACCGGGCCCTCACTGTGCCTG
	mTUBB short R	528	10 µM	10.0 µl for 1ml	CGTCCACGGAAGACGGCGGCA
Expected Bands:	Band Size: 118.0	Description: mTUBB5-118	(text displayed in the image)
	Band Size: 570.0	Description: 570 ko	(text displayed in the image)
More Information in PDF:		view PDF