PCR: | Del-1 wt |
Name of Positive CTRL: | Del-1 wt |
Annealing Temperature: | 60.0 °C | Number of cycles: | 35.0 |
Extension Time: | 45 s | Hot Start: | HS 57 |
Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| Del-1 fwd | 104 | 100 µM | 20.0 µl for 1ml | tcttgaatctctgacagggc |
| Del-1 rev | 105 | 100 µM | 20.0 µl for 1ml | ctttgccgaactggggcac |
| mTUBB short F | 527 | 10 µM | 10.0 µl for 1ml | ACCGGGCCCTCACTGTGCCTG |
| mTUBB short R | 528 | 10 µM | 10.0 µl for 1ml | CGTCCACGGAAGACGGCGGCA |
|
Expected Bands: | Band Size: 118.0 | Description: mTUBB5-118 | (text displayed in the image) |
| Band Size: 180.0 | Description: 180 wt | (text displayed in the image) |
|
|
More Information in PDF: | | view PDF | |
|