| PCR: | CR2 |
| Name of Positive CTRL: | CR2 |
Annealing Temperature: | 55.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 60 s | | Hot Start: | Not yet |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| CR1/2 a | 504 | 100 µM | 20.0 µl for 1ml | TGTCAGGCTCCTCCTAAAATTAT |
| CR1/2 b | 505 | 100 µM | 10.0 µl for 1ml | CTTTACAAAGACGGATTTCTATA |
| CR1/2 c | 506 | 100 µM | 10.0 µl for 1ml | CCACTGTCCTTTCCTAATAAAATG |
|
| Expected Bands: | Band Size: 474.0 | Description: neo | (text displayed in the image) |
| Band Size: 693.0 | Description: wt | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |