| PCR: | Kras wt |
| Name of Positive CTRL: | Kras wt |
Annealing Temperature: | 65.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 45 s | | Hot Start: | Not yet |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| IMR8272 | 496 | 100 µM | 20.0 µl for 1ml | GTC GAC AAG CTC ATG CGG G |
| IMR8273 | 497 | 100 µM | 20.0 µl for 1ml | CGC AGA CTG TAG AGC AGC G |
| mTUBB short F | 527 | 10 µM | 10.0 µl for 1ml | ACCGGGCCCTCACTGTGCCTG |
| mTUBB short R | 528 | 10 µM | 10.0 µl for 1ml | CGTCCACGGAAGACGGCGGCA |
|
| Expected Bands: | Band Size: 118.0 | Description: mTUBB5-118 | (text displayed in the image) |
| Band Size: 507.0 | Description: 507 wt | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |