PCR:	LysMCre mut
Name of Positive CTRL:	LysMCre mut
Annealing Temperature:	62.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Cre8	453	100 µM	20.0 µl for 1ml	CCC AGA AAT GCC AGA TTA CG
	MLys1	451	100 µM	20.0 µl for 1ml	CTT GGG CTG CCA GAA TTT CTC
	mTUBB short F	527	10 µM	10.0 µl for 1ml	ACCGGGCCCTCACTGTGCCTG
	mTUBB short R	528	10 µM	10.0 µl for 1ml	CGTCCACGGAAGACGGCGGCA
Expected Bands:	Band Size: 118.0	Description: 118 mTUBBs	(text displayed in the image)
	Band Size: 700.0	Description: 700 mut	(text displayed in the image)
More Information in PDF:		view PDF