PCR:	MacGreen
Name of Positive CTRL:	MacGreen
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	45 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	m28s rDNA 225 F	390	10 µM	20.0 µl for 1ml	CAG ACG TGG CGA CCC GCT GA
	m28s rDNA-225 R	276	10 µM	20.0 µl for 1ml	GCC TCA CAC CGT CCA CGG GC
	MacGreen_fwd	400	100 µM	20.0 µl for 1ml	CTG GTC GAG CTG GAC GGC GAC G
	MacGreen_rev	401	100 µM	20.0 µl for 1ml	CCAGAGACGGAAATCCATCGCTCG
Expected Bands:	Band Size: 225.0	Description: m28s 225	(text displayed in the image)
	Band Size: 670.0	Description: 670 MG	(text displayed in the image)
More Information in PDF:		view PDF