PCR:	PrP Ed wt
Name of Positive CTRL:	PrP Ed wt
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	45 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	129Ola1	271	100 µM	20.0 µl for 1ml	ATGGTGGTAGTTGGGGTCAG
	129Ola2	272	100 µM	20.0 µl for 1ml	TCATCTTCACATCGGTCTCG
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
Expected Bands:	Band Size: 387.0	Description: 387wt	(text displayed in the image)
	Band Size: 500.0	Description: 500 actin	(text displayed in the image)
More Information in PDF:		view PDF