PCR:	GFAP-Mfge8
Name of Positive CTRL:	GFAP-Mfge8
Annealing Temperature:	58.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	GFAP-M8 fwd	263	100 µM	20.0 µl for 1ml	ACCCACCTTCCTAGAGAGAG
	GFAP-M8 rev	264	100 µM	20.0 µl for 1ml	GCAGAGGCAGTAGATGTCAT
	m28s rDNA 225 F	390	10 µM	20.0 µl for 1ml	CAG ACG TGG CGA CCC GCT GA
	m28s rDNA-225 R	276	10 µM	20.0 µl for 1ml	GCC TCA CAC CGT CCA CGG GC
Expected Bands:	Band Size: 225.0	Description: m28s 225	(text displayed in the image)
	Band Size: 499.0	Description: 499bp	(text displayed in the image)
More Information in PDF:		view PDF