| PCR: | Rip3 |
| Name of Positive CTRL: | Rip3 |
Annealing Temperature: | 60.0 °C | | Number of cycles: | 30.0 |
Extension Time: | 60 s | | Hot Start: | Not yet |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| RIP 3-1 | 330 | 100 µM | 10.0 µl for 1ml | CGCTTTAGAAGCCTTCAGGTTGAC |
| RIP 3-2 | 331 | 100 µM | 10.0 µl for 1ml | GCCTGCCCATCAGCAACTC |
| RIP 3-3 | 332 | 100 µM | 10.0 µl for 1ml | CCAGAGGCCACTTGTGTAGCG |
|
| Expected Bands: | Band Size: 320.0 | Description: 320 wt | (text displayed in the image) |
| Band Size: 485.0 | Description: 485 ko | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |