PCR:	APP/PS1
Name of Positive CTRL:	APP/PS1
Annealing Temperature:	58.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	20.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	20.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	APPCT-1F	58	100 µM	10.0 µl for 1ml	GAATTCCGACATGACTCAGG
	APPCT-1R	59	100 µM	10.0 µl for 1ml	GTTCTGCTGCATCTTGGACA
	PS1-fwd	60	100 µM	10.0 µl for 1ml	CAG GTG CTA TAA GGT CAT CC
	PS1-rev	61	100 µM	10.0 µl for 1ml	ATC ACA GCC AAG ATG AGC CA
Expected Bands:	Band Size: 250.0	Description: 250 APP	(text displayed in the image)
	Band Size: 300.0	Description: 300 PS1	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF