PCR: HSA Ltab
Name of Positive CTRL:HSA Ltab
Annealing Temperature:65.0 °C
Number of cycles:40.0
Extension Time:30 s
Hot Start:Not yet
Primers:Primer:ID:Working Stock Concentration:Volume:Sequence (5'-3'):
HSA fwd194100 µM10.0 µl for 1mlcagtcggttcacctggtcag
LT a rev219100 µM10.0 µl for 1mlaccctcaagaggtggagacg
LT b rev230100 µM10.0 µl for 1mlaggccagcacagccaggaca
Expected Bands:Band Size: 150.0Description: 150 HSA LT(text displayed in the image)
Band Size: 250.0Description: 250 HSA LT(text displayed in the image)
 
More Information in PDF: view PDF