PCR:	Tre-Tau
Name of Positive CTRL:	Tre-Tau
Annealing Temperature:	59.0 °C
Number of cycles:	35.0
Extension Time:	40 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	mTUBB short F	527	10 µM	10.0 µl for 1ml	ACCGGGCCCTCACTGTGCCTG
	mTUBB short R	528	10 µM	10.0 µl for 1ml	CGTCCACGGAAGACGGCGGCA
	treTau-F106	413	100 µM	20.0 µl for 1ml	5-TGA ACC AGG ATG GCT GAG C-3
	treTau-R107	427	100 µM	20.0 µl for 1ml	5-TTG TCA TCG CTT CCA GTC C-3
Expected Bands:	Band Size: 118.0	Description: mTUBB5-118	(text displayed in the image)
	Band Size: 250.0	Description: 250 Tg	(text displayed in the image)
More Information in PDF:		view PDF