PCR:	sN1
Name of Positive CTRL:	sN1
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	45 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	m28s rDNA 225 F	390	10 µM	20.0 µl for 1ml	CAG ACG TGG CGA CCC GCT GA
	m28s rDNA-225 R	276	10 µM	20.0 µl for 1ml	GCC TCA CAC CGT CCA CGG GC
	pE2	2	100 µM	20.0 µl for 1ml	caaccgagctgaagcattctgcct
	sN1	345	100 µM	20.0 µl for 1ml	5 - CAGGAAGGCCTCCCTCACACATG - 3
Expected Bands:	Band Size: 225.0	Description: m28s rDNA	(text displayed in the image)
	Band Size: 417.0	Description: 417	(text displayed in the image)
More Information in PDF:		view PDF