PCR:	JNK2 flox
Name of Positive CTRL:	JNK2 flox
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	GS.J2H3-F	185	100 µM	10.0 µl for 1ml	GTTTTGTAAAGGGAGCCGAC
	GS.J2H3-R	186	100 µM	10.0 µl for 1ml	CCTGACTACTGAGCCTGGTTTCTC
Expected Bands:	Band Size: 224.0	Description: 224 wt	(text displayed in the image)
	Band Size: 264.0	Description: 264 mut	(text displayed in the image)
More Information in PDF:		view PDF