| PCR: | JNK1 flox | ||||
| Name of Positive CTRL: | JNK1 flox | Annealing Temperature: | 58.0 °C | ||
| Number of cycles: | 35.0 | Extension Time: | 40 s | ||
| Hot Start: | Not yet | ||||
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| MD-F2 flox | 244 | 100 µM | 10.0 µl for 1ml | AGGATTTATGCCCTCTGCTTGTC | |
| MD-R2 flox | 245 | 100 µM | 10.0 µl for 1ml | GAACCACTGTTCCAATTTCCATCC | |
| Expected Bands: | Band Size: 330.0 | Description: 330 mut | (text displayed in the image) | ||
| Band Size: 540.0 | Description: 540 wt | (text displayed in the image) | |||
| More Information in PDF: | view PDF | ||||