| PCR: | SHPS-1 |
| Name of Positive CTRL: | SHPS-1 |
Annealing Temperature: | 60.0 °C | | Number of cycles: | 30.0 |
Extension Time: | 60 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| AS-7 | 123 | 100 µM | 20.0 µl for 1ml | TAGTACAGACCACAGCCCCATTCACTTCCT |
| GS-1 | 411 | 100 µM | 10.0 µl for 1ml | ATACCATTGGCTGAGCCCACTGGGAAAGAA |
| SHPS-1 Neo | 344 | 100 µM | 10.0 µl for 1ml | TCGTGCTTTACGGTATCGCCGCTCCCGAAT |
|
| Expected Bands: | Band Size: 280.0 | Description: 280 ko | (text displayed in the image) |
| Band Size: 380.0 | Description: 380 wt | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |