PCR:	LacZ
Name of Positive CTRL:	LacZ
Annealing Temperature:	50.0 °C
Number of cycles:	35.0
Extension Time:	35 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	lacZ F	789	100 µM	20.0 µl for 1ml	CATCTACACCAACGTAACCTATCC
	lacZ R	790	100 µM	20.0 µl for 1ml	GATAACTGCCGTCACTCCAACGCAG
Expected Bands:	Band Size: 296.0	Description: 296 lacZ	(text displayed in the image)
More Information in PDF:		view PDF