| PCR: | Caspase-1 |
| Name of Positive CTRL: | Caspase-1 |
Annealing Temperature: | 58.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 60 s | | Hot Start: | Not yet |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| -1 | 78 | 100 µM | 10.0 µl for 1ml | CTGTGG TGACTAACCGATAA |
| -2 | 77 | 100 µM | 10.0 µl for 1ml | CATGCCTGAATAATGATGACC |
| -3 | 76 | 100 µM | 10.0 µl for 1ml | GCGCCTCCCCTACCCGG |
|
| Expected Bands: | Band Size: 491.0 | Description: wt | (text displayed in the image) |
| Band Size: 510.0 | Description: ko | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |