PCR: | PGRN neo |
Name of Positive CTRL: | PGRN neo |
Annealing Temperature: | 58.0 °C | Number of cycles: | 35.0 |
Extension Time: | 30 s | Hot Start: | HS 57 |
Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| m28s rDNA 225 F | 390 | 10 µM | 20.0 µl for 1ml | CAG ACG TGG CGA CCC GCT GA |
| m28s rDNA-225 R | 276 | 10 µM | 20.0 µl for 1ml | GCC TCA CAC CGT CCA CGG GC |
| PGRN Neo F | 295 | 100 µM | 10.0 µl for 1ml | ccaatatgggatcggccattgaac |
| PGRN Neo R | 296 | 100 µM | 10.0 µl for 1ml | cgctcgatgcgatgtttcgcttgg |
|
Expected Bands: | Band Size: 225.0 | Description: 225 m28s | (text displayed in the image) |
| Band Size: 500.0 | Description: 500 neo | (text displayed in the image) |
|
|
More Information in PDF: | | view PDF | |
|