PCR: PGRN neo
Name of Positive CTRL:PGRN neo
Annealing Temperature:58.0 °C
Number of cycles:35.0
Extension Time:30 s
Hot Start:HS 57
Primers:Primer:ID:Working Stock Concentration:Volume:Sequence (5'-3'):
m28s rDNA 225 F39010 µM20.0 µl for 1mlCAG ACG TGG CGA CCC GCT GA
m28s rDNA-225 R27610 µM20.0 µl for 1mlGCC TCA CAC CGT CCA CGG GC
PGRN Neo F295100 µM10.0 µl for 1mlccaatatgggatcggccattgaac
PGRN Neo R296100 µM10.0 µl for 1mlcgctcgatgcgatgtttcgcttgg
Expected Bands:Band Size: 225.0Description: 225 m28s(text displayed in the image)
Band Size: 500.0Description: 500 neo(text displayed in the image)
 
More Information in PDF: view PDF