PCR:	CAPN4 wt
Name of Positive CTRL:	CAPN4 wt
Annealing Temperature:	60.0 °C
Number of cycles:	39.0
Extension Time:	40 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	CAPN4-fwd(1)	134	100 µM	20.0 µl for 1ml	GTC AGG CTA GAT GCC ATG TTC C
	CAPN4-r452	135	100 µM	20.0 µl for 1ml	CAAGATGGAGCTGGAGAGAT
	mTUBB5-247 F	277	100 µM	10.0 µl for 1ml	CGG CCA CCA TGA GCG GCG TC
	mTUBB5-247 R	392	100 µM	10.0 µl for 1ml	GTG AGG TAC CGG CCG TGG CG
Expected Bands:	Band Size: 247.0	Description: 247 mTUBB	(text displayed in the image)
	Band Size: 500.0	Description: 500 wt	(text displayed in the image)
More Information in PDF:		view PDF