PCR:	Tg63
Name of Positive CTRL:	Tg63
Annealing Temperature:	58.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	m28s rDNA 225 F	390	10 µM	10.0 µl for 1ml	CAG ACG TGG CGA CCC GCT GA
	m28s rDNA-225 R	276	10 µM	10.0 µl for 1ml	GCC TCA CAC CGT CCA CGG GC
	tg63neuAS02	35	100 µM	10.0 µl for 1ml	catcactcgttgcatcgaccgg
	tg63neuS	36	100 µM	10.0 µl for 1ml	ccggagtcccagagctgcc
Expected Bands:	Band Size: 180.0	Description: 180 Tg63	(text displayed in the image)
	Band Size: 225.0	Description: 225 m28s	(text displayed in the image)
More Information in PDF:		view PDF