PCR:	hCAST
Name of Positive CTRL:	hCAST
Annealing Temperature:	58.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	CAST F	137	100 µM	20.0 µl for 1ml	AAGGCCATTCCAGTCAGCCA
	CAST R	138	100 µM	20.0 µl for 1ml	AGCAACACTCTCTCCAC
	m28s rDNA 225 F	390	10 µM	20.0 µl for 1ml	CAG ACG TGG CGA CCC GCT GA
	m28s rDNA-225 R	276	10 µM	20.0 µl for 1ml	GCC TCA CAC CGT CCA CGG GC
Expected Bands:	Band Size: 225.0	Description: m28s 225	(text displayed in the image)
	Band Size: 300.0	Description: 300	(text displayed in the image)
More Information in PDF:		view PDF