PCR:	Elap
Name of Positive CTRL:	Elap
Annealing Temperature:	60.0 °C
Number of cycles:	40.0
Extension Time:	50 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	ElaF2	166	100 µM	10.0 µl for 1ml	atacatagcggccgctatgaaaaaaaaagcaatcctc
	ElaRev1	167	100 µM	10.0 µl for 1ml	gctcggtacccggggatcccgaga
Expected Bands:	no expected bands in db
More Information in PDF:		view PDF