PCR: PGRN wt
Name of Positive CTRL:PGRN wt
Annealing Temperature:58.0 °C
Number of cycles:35.0
Extension Time:60 s
Hot Start:HS 57
Primers:Primer:ID:Working Stock Concentration:Volume:Sequence (5'-3'):
m28s rDNA 225 F39010 µM10.0 µl for 1mlCAG ACG TGG CGA CCC GCT GA
m28s rDNA-225 R27610 µM10.0 µl for 1mlGCC TCA CAC CGT CCA CGG GC
PGRN wt F297100 µM20.0 µl for 1mlcatgtgactgatgactgtcc
PGRN wt R298100 µM20.0 µl for 1mlgagcaagacgcttttgcttg
Expected Bands:Band Size: 225.0Description: 225 m28s(text displayed in the image)
Band Size: 1000.0Description: 1000 wt(text displayed in the image)
 
More Information in PDF: view PDF