PCR:	CNCE ko
Name of Positive CTRL:	CNCE ko
Annealing Temperature:	50.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	CNP-E3antisense	380	100 µM	20.0 µl for 1ml	CCCAGCCCTTTTATTACCAC
	CNP-Puro3 (neo)	146	100 µM	20.0 µl for 1ml	cat agc ctg aag aac gag a
Expected Bands:	Band Size: 400.0	Description: 400 ko	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF