PCR:	CNCE wt
Name of Positive CTRL:	CNCE wt
Annealing Temperature:	50.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	5.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	5.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	CNP-E3 sense (common)	145	100 µM	10.0 µl for 1ml	gcc ttc aaa ctg tcc atc tc
	CNP-E3antisense	380	100 µM	10.0 µl for 1ml	CCCAGCCCTTTTATTACCAC
Expected Bands:	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
	Band Size: 700.0	Description: 700	(text displayed in the image)
More Information in PDF:		view PDF