PCR:	UblfloxedDpl
Name of Positive CTRL:	UblfloxedDpl
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	50 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	pE2	2	100 µM	10.0 µl for 1ml	caaccgagctgaagcattctgcct
	UBIfloxedDpl3	371	100 µM	10.0 µl for 1ml	ctcgctggtggagcttgctatc
Expected Bands:	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
	Band Size: 618.0	Description: 618 CD-Dpl	(text displayed in the image)
	Band Size: 670.0	Description: 670Prp-Dpl	(text displayed in the image)
More Information in PDF:		view PDF