PCR:	Tg338
Name of Positive CTRL:	Tg338
Annealing Temperature:	56.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	tg338F	33	100 µM	10.0 µl for 1ml	aaccgctatccacctcaggg
	tg338R	34	100 µM	10.0 µl for 1ml	aaagaggatcacacttgc
Expected Bands:	Band Size: 560.0	Description: 560	(text displayed in the image)
More Information in PDF:		view PDF