PCR:	Rorc
Name of Positive CTRL:	Rorc
Annealing Temperature:	50.0 °C
Number of cycles:	35.0
Extension Time:	40 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	oIMR7374	688	100 µM	10.0 µl for 1ml	CCAGTGCACATGAATTGGAG
	oIMR7375	689	100 µM	20.0 µl for 1ml	GGGCTGTGGGTAGAAGAACA
	oIMR7376	690	100 µM	10.0 µl for 1ml	CCACACGCGTCACCTTAATA
Expected Bands:	Band Size: 342.0	Description: 342 wt	(text displayed in the image)
	Band Size: 450.0	Description: 450 mut	(text displayed in the image)
More Information in PDF:		view PDF