PCR:	RAG2 wt/ko
Name of Positive CTRL:	RAG2 wt/ko
Annealing Temperature:	55.0 °C
Number of cycles:	35.0
Extension Time:	45 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Rag 2A=Rag1	223	100 µM	20.0 µl for 1ml	GGGAGGACACTCACTTGCCAGTA
	RAG 2B=Rag2	224	100 µM	10.0 µl for 1ml	AGTCAGGAGTCTCCATCTCACTGA
	Rag2 neo= Ragneo	225	100 µM	10.0 µl for 1ml	CGGCCGGAGAACCTGCGTGCAA
Expected Bands:	Band Size: 263.0	Description: 263 wt	(text displayed in the image)
	Band Size: 350.0	Description: 350 ko	(text displayed in the image)
More Information in PDF:		view PDF