PCR:	PrP del C4
Name of Positive CTRL:	PrP del C4
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	35 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	P10 del C4	281	100 µM	20.0 µl for 1ml	ggc tgg gct tgt tcc act gat tat ggg
	pE2	2	100 µM	20.0 µl for 1ml	caaccgagctgaagcattctgcct
Expected Bands:	Band Size: 195.0	Description: 195 C4	(text displayed in the image)
	Band Size: 500.0	Description: 500 Actin	(text displayed in the image)
More Information in PDF:		view PDF