PCR:	PLP
Name of Positive CTRL:	PLP
Annealing Temperature:	55.0 °C
Number of cycles:	35.0
Extension Time:	40 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	mTUBB5-247 F	277	100 µM	10.0 µl for 1ml	CGG CCA CCA TGA GCG GCG TC
	mTUBB5-247 R	392	100 µM	10.0 µl for 1ml	GTG AGG TAC CGG CCG TGG CG
	PLP-Fwd	300	100 µM	10.0 µl for 1ml	tcatttttaagaatgggacagctgg
	PLP-Rev	301	100 µM	10.0 µl for 1ml	tttgctgggcttgttccact
Expected Bands:	Band Size: 247.0	Description: mTUBB5-247	(text displayed in the image)
	Band Size: 600.0	Description: 600	(text displayed in the image)
More Information in PDF:		view PDF