PCR:	P53 wt
Name of Positive CTRL:	P53 wt
Annealing Temperature:	55.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	p53-3	622	100 µM	10.0 µl for 1ml	AGAGCAAGAATAAGTCAGAAGCCG
	p53-5	623	100 µM	10.0 µl for 1ml	GTCCGCGCCATGGCCATCTA
Expected Bands:	Band Size: 180.0	Description: 180 wt	(text displayed in the image)
	Band Size: 500.0	Description: 500 actin	(text displayed in the image)
More Information in PDF:		view PDF