PCR:	NSE
Name of Positive CTRL:	NSE
Annealing Temperature:	62.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	m28s rDNA 225 F	390	10 µM	10.0 µl for 1ml	CAG ACG TGG CGA CCC GCT GA
	m28s rDNA-225 R	276	10 µM	10.0 µl for 1ml	GCC TCA CAC CGT CCA CGG GC
	NSE E1 rev	279	100 µM	20.0 µl for 1ml	gacgcagcgcccagaatcgg
	NSE I'1 fwd	280	100 µM	20.0 µl for 1ml	actggtcggtgaagctgctgaggg
Expected Bands:	Band Size: 225.0	Description: 225 m28S	(text displayed in the image)
	Band Size: 390.0	Description: 390	(text displayed in the image)
More Information in PDF:		view PDF