PCR:	NGPI
Name of Positive CTRL:	NGPI
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	40 s
Hot Start:	HS 60
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	mTUBB5-247 F	277	100 µM	10.0 µl for 1ml	CGG CCA CCA TGA GCG GCG TC
	mTUBB5-247 R	392	100 µM	10.0 µl for 1ml	GTG AGG TAC CGG CCG TGG CG
	pE2	2	100 µM	20.0 µl for 1ml	caaccgagctgaagcattctgcct
	Prp-3'NC	5	100 µM	20.0 µl for 1ml	CCC TCC CCC AGC CTA GAC CAC GA
Expected Bands:	Band Size: 247.0	Description: 247mTUBB	(text displayed in the image)
	Band Size: 650.0	Description: 650	(text displayed in the image)
More Information in PDF:		view PDF