PCR:	Nalp3
Name of Positive CTRL:	Nalp3
Annealing Temperature:	55.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 53
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	JT 6030Ay	212	100 µM	15.0 µl for 1ml	aagtcgtgctgcttcatgt
	JT 6031Ay	213	100 µM	20.0 µl for 1ml	tcaagctaagagaactttctg
	JT 6032Ay	214	100 µM	5.0 µl for 1ml	acactcgtcatcttcagca
Expected Bands:	Band Size: 250.0	Description: 250 wt	(text displayed in the image)
	Band Size: 500.0	Description: 500 mut	(text displayed in the image)
More Information in PDF:		view PDF