| PCR: | Mut217 |
| Name of Positive CTRL: | Mut217 |
Annealing Temperature: | 60.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 50 s | | Hot Start: | HS 62 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| m28s rDNA 225 F | 390 | 10 µM | 5.0 µl for 1ml | CAG ACG TGG CGA CCC GCT GA |
| m28s rDNA-225 R | 276 | 10 µM | 5.0 µl for 1ml | GCC TCA CAC CGT CCA CGG GC |
| Mut217 | 88 | 100 µM | 20.0 µl for 1ml | cctgggactccttctggtaccgggtgacgc |
| pE2 | 2 | 100 µM | 20.0 µl for 1ml | caaccgagctgaagcattctgcct |
|
| Expected Bands: | Band Size: 225.0 | Description: 225 m28s | (text displayed in the image) |
| Band Size: 430.0 | Description: 430 F35 | (text displayed in the image) |
| Band Size: 500.0 | Description: 500 Actin | (text displayed in the image) |
| Band Size: 680.0 | Description: 680 Tg42 | (text displayed in the image) |
| Band Size: 750.0 | Description: 750 Tga20 | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |