PCR: Mut217
Name of Positive CTRL:Mut217
Annealing Temperature:60.0 °C
Number of cycles:35.0
Extension Time:50 s
Hot Start:HS 60
Primers:Primer:ID:Working Stock Concentration:Volume:Sequence (5'-3'):
m28s rDNA 225 F39010 µM10.0 µl for 1mlCAG ACG TGG CGA CCC GCT GA
m28s rDNA-225 R27610 µM10.0 µl for 1mlGCC TCA CAC CGT CCA CGG GC
Mut21788100 µM20.0 µl for 1mlcctgggactccttctggtaccgggtgacgc
pE22100 µM20.0 µl for 1mlcaaccgagctgaagcattctgcct
Expected Bands:Band Size: 225.0Description: 225 m28s(text displayed in the image)
Band Size: 430.0Description: 430 F35(text displayed in the image)
Band Size: 500.0Description: 500 Actin(text displayed in the image)
Band Size: 680.0Description: 680 Tg42(text displayed in the image)
Band Size: 750.0Description: 750 Tga20(text displayed in the image)
 
More Information in PDF: view PDF