PCR:	mohu PS1
Name of Positive CTRL:	mohu PS1
Annealing Temperature:	58.0 °C
Number of cycles:	35.0
Extension Time:	50 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	PSN1644	314	100 µM	10.0 µl for 1ml	aatagagaacggcaggagca
	PSN1645	315	100 µM	10.0 µl for 1ml	gccatgagggcactaatcat
Expected Bands:	Band Size: 600.0	Description: 600	(text displayed in the image)
More Information in PDF:		view PDF