PCR:	mohu APP
Name of Positive CTRL:	mohu APP
Annealing Temperature:	58.0 °C
Number of cycles:	35.0
Extension Time:	50 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	APP1597	121	100 µM	10.0 µl for 1ml	gactgaccactcgaccaggttctg
	APP1598	122	100 µM	10.0 µl for 1ml	cttgtaagttggattctcatatccg
Expected Bands:	Band Size: 350.0	Description: 350	(text displayed in the image)
More Information in PDF:		view PDF