| PCR: | Mfg-Tomato |
| Name of Positive CTRL: | Mfg-Tomato |
Annealing Temperature: | 60.0 °C | | Number of cycles: | 35.0 |
Extension Time: | 40 s | | Hot Start: | HS 60 |
| Primers: | Primer: | ID: | Working Stock Concentration: | Volume: | Sequence (5'-3'): |
| Mfge8 E1 3 down | 247 | 100 µM | 20.0 µl for 1ml | CACGTTCGCCTCTCCTACC |
| mTUBB short F | 527 | 10 µM | 15.0 µl for 1ml | ACCGGGCCCTCACTGTGCCTG |
| mTUBB short R | 528 | 10 µM | 15.0 µl for 1ml | CGTCCACGGAAGACGGCGGCA |
| Tom poly A | 369 | 100 µM | 20.0 µl for 1ml | CTGTTCCTGTACGGCATGG |
|
| Expected Bands: | Band Size: 118.0 | Description: mTUBB5-118 | (text displayed in the image) |
| Band Size: 625.0 | Description: 625 mfg-To | (text displayed in the image) |
|
| |
| More Information in PDF: | | view PDF | |
| |