PCR:	Mfg-Prnp
Name of Positive CTRL:	Mfg-Prnp
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	40 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Cre down	149	100 µM	10.0 µl for 1ml	GGGGAGGGGCAAACAACAGATGGCT
	mTUBB5-247 F	277	100 µM	10.0 µl for 1ml	CGG CCA CCA TGA GCG GCG TC
	mTUBB5-247 R	392	100 µM	10.0 µl for 1ml	GTG AGG TAC CGG CCG TGG CG
	Prp-P10	6	100 µM	10.0 µl for 1ml	GTA CCC ATA ATC AGT GGA ACA AGC CCA GC
Expected Bands:	Band Size: 247.0	Description: mTUBB 247	(text displayed in the image)
	Band Size: 620.0	Description: 620 Prnp	(text displayed in the image)
More Information in PDF:		view PDF